The genetic influence of VEGFA single nucleotide polymorphism (SNP) (rs1570360) on the risk, disease activity, and severity in systemic lupus erythematosus patients.

INTRODUCTION

Rheumatic disorders are a wide and diverse category of illnesses with an autoimmune component ¹.  SLE is a debilitating multisystem rheumatic illness with wide epidemiological heterogeneity² and is characterized by immune system dysfunction and phenotypic variability.³ As a result, understanding the molecular pathways involved in the pathophysiology of SLE manifestations could be important for developing more effective treatment and prophylactic interventions.⁴

SLE is a chronic autoimmune disease caused by a lack of immunological tolerance and the development of autoantibodies on a long-term basis ⁵ and it is a chronic autoimmune illness in which numerous variables, including epigenetic, genetic, and environmental factors, interact to determine disease risk.⁶ The existence of multiple autoantibodies, which resulted in the development and deposition of immunological complexes, could be regarded as disease markers.⁷ Despite the fact that the death rate among SLE patients has dropped significantly, the disease still has a significant physical and psychological impact.⁸ When vascular endothelial cells are damaged and activated, the pathogenesis of SLE may begin. SLE manifests in Egypt in a wide range of clinical and immunological forms.⁹

Despite the diversity of appearances, the pathophysiology of rheumatic diseases is strikingly similar in many ways. With the help of inflammatory cytokines and growth factors, as well as the participation of vascular endothelium, inflammatory processes proliferate through many types of immune system cells and tissues.¹⁰  One factor of them is Vascular endothelial growth factor (VEGF) which is still being studied for its impact on the genesis and progression of rheumatic illnesses.¹¹ However, in SLE patients, its serum level was noticeably elevated and may be used as a possible indicator of disease activity. VEGF may have a role in the pathogenesis of SLE, and as its concentration appears to be a measure of activity, it may be useful for disease monitoring and therapy planning.¹²

In individuals with knee osteoarthritis, serum and synovial Vascular Endothelial Growth Factor (VEGF) levels were linked to clinical, functional, radiographic, and ultrasound (U/S) severity.¹³ The VEGF family includes placental growth factor, VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-E, and VEGF-F.¹⁴ On chromosome 6p12, the VEGF gene is present. It has eight exons. The most potent angiogenic factors include VEGF. It promotes endothelial cell migration and proliferation, which results in neovascularization and a rise in vascular permeability, and hence increases angiogenesis.¹⁵ VEGF, a member of the platelet-derived growth factor family and a crucial regulator of angiogenesis and vascular remodeling, is expressed in inflammatory cells such monocytes, lymphocytes, neutrophils, and eosinophils as well as tissues rich in blood vessels like lung tissue.¹⁶ Additionally, since inflammatory cells secrete VEGF, the inflammatory component in many disorders may be represented by it.¹⁷

In autoinflammatory illnesses, angiogenesis is a symptom of inflammatory activation, indicating histopathologic processes such as endothelial cell proliferation and migration, as well as subsequent vascular remodeling.¹⁸

Angiogenesis is a significant pathogenic mechanism in autoimmune disorders, which are characterized by immune-mediated tissue destruction. The angiogenesis modulator VEGF is highly raised in numerous autoimmune disorders, including systemic sclerosis, rheumatoid arthritis (RA), and SLE.¹⁹

In people with systemic sclerosis, increased levels of the potent angiogenic molecule VEGF or decreased levels of its natural inhibitors may contribute to the development of vasculopathy.²⁰ The relationship between SLE and a VEGF gene polymorphism is rarely studied.²¹

The aim of the present study was to evaluate whether vascular endothelial growth factor (VEGF) 1154G/A single nucleotide polymorphism (SNP) is associated with systemic lupus erythematosus (SLE) risk & disease activity.

PATIENTS AND METHODS

50 SLE patients and 50 healthy participants (normal controls) were recruited from Rheumatology and Rehabilitation Department at Beni-Suef University Hospital. All patients had previously been identified as having SLE according to European League Against Rheumatism/ American College of Rheumatology (EULAR/ACR) classification criteria (2019).²² Any patient who had known to have underlying chronic diseases other than SLE was excluded.

All study participants had comprehensive clinical examinations and full history taking. Complete blood count (CBC), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), liver, and renal function tests were done for all individuals. On the other hand, complement 3 (C3), complement 4 (C4), anti-double-stranded deoxyribonucleic acid (anti-dsDNA), Anti-nuclear antibodies (ANA), urine analysis, and 24-hour urinary proteins were done for SLE patients only. Patients with SLE underwent renal biopsy when necessary, and the findings were categorized in accordance with the International Society of Nephrology/Renal Pathology Society (ISN/RPS) lupus nephritis diagnostic system.²³

The Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) was used to assess SLE disease activity²⁴ while the Systemic Lupus International Collaborating Clinics Damage Index (SLICC DI) was used to assess the extent of the damage.²⁵

The research was approved by the Beni-Suef University Ethical Committee (FWA#: FWA00015574). Before being included in the study, all the patients gave their informed consent.

Detection of VEGFA SNP (rs1570360) by Real-time PCR: 3 ml of venous blood was drawn from each participant. The samples were kept at -20° C in the same vacutainer (EDTA tube) for DNA extraction. Using the QIAamp DNA Mini Kit, DNA extraction was conducted according to the manufacturer's procedure (cat. No 51104, QIAGEN).

The following primers were used:                                             AGCCCGGGCCCGAGCCGCGCGTGGA[A/G] GGGCTGAGGCTCGCCTGTCCCCGCC. RT-PCR was used to detect the (VEGF) 1154G/A (rs1570360) SNP using the TaqMan allelic discrimination approach. Step-one real-time PCR of Applied Biosystems (USA) was used to execute the PCR reaction.  

Statistical analysis:  The Statistical Package for the Social Sciences (SPSS) version 22 was used. For numerical data, means, standard deviations (SD), median, and range were used. Qualitative data was represented using frequency and percentages. Pearson's Chi-square or Fisher's exact tests were used to determine the results. Quantitative data from two groups was compared using a student t-test or Mann-Whitney test. The Bonferroni method was used to correct the p-value when multiple comparisons were made. The odds ratio (OR) and its 95 percent confidence interval (CI) were obtained for risk estimation using logistic regression.

RESULTS

SLE patients had a mean age of 39.2±9.4 years, with 35(70%) females and 15(30%) males, while the control group had a mean age of 40.1± 13 years, with 36 (72%) females and 14(28%) males. All clinical findings and laboratory investigations of SLE patients are summarized in table-1. The number of patients with renal disorder was 23 (46%), class 2 were 10 patients (20.0%), class 3 were 3 patients        (6.0%) and class 4 were 10 patients (20.0%). 

Table 1: Clinical Findings & Laboratory investigations of SLE patients.

Abbreviations: anti- CCP: anti-cyclic citrullinated peptide, ESR; erythrocyte sedimentation rate, TLC: total leukocytic count, RA: rheumatoid arthritis, SLE: systemic lupus erythematosus, Hb: hemoglobin, C: complement, CRP: C-reactive protein, ANA: antinuclear antibodies, SLICC: Systemic Lupus International Collaborating Clinics Damage Index, SLEDAI: systemic lupus erythematosus disease activity index, dsDNA: double-stranded deoxyribonucleic acid.

Regarding the genetic effect of VEGFA (rs1570360) SNP on SLE patients; no statistically significant correlation was detected between VEGF -1154 SNP genotype frequency distribution under the codominant, dominant and recessive models (Table-2). However, our study revealed that the A allele was predominant in the healthy group compared to the patients with p-value 0.033 (Table-3).

On comparing the homozygous mutant type (AA) in cases and controls, it was 34 % in SLE patients compared to 54 % in controls. With an odds ratio of 2.193, the difference was not statistically significant (P= 0.063 and 95 % CI:0.959-5.014). While the heterozygous genotype (GA) was more prevalent in cases (8%) in comparison to controls (4%). The difference was not statistically significant P= 0.685 with an odds ratio 0.690 (95 % CI: 0.116 - 4.127) as shown in Table-2.

Table 2: Risk of SLE in different genetic models of VEGF (1154G/A).

Table 3: Allele frequency distribution of VEGF in SLE and control groups.

There was a statistically significant difference between the frequencies of the A allele, which was present in 38 percent of SLE patients and 56 percent of controls, and the G allele, which was present in 62 percent of SLE patients and 44 percent of controls (p-value 0.033, odds ratio 0.482 and 95 % CI: 0.274 - 0.847) as demonstrated in Figure-1 and Table-3.

Regarding the distribution of genotypes according to age of the patients (P = 0.395), duration of the disease (p = 0.240), creatinine (P = 0.800), PLT (P=0.129), 24 hours urinary protein (P=0.062), SLEDAI (P=0.922) and C3 (P=0.202), there was no statistically significant difference between the patients. On the other hand, there was statistically significant difference on comparing different genotypes of VEGF -1154 SNP (G/A) on SLE patients in relation to ESR, Hb, TLC and C4 (p-value 0.007, 0.029, 0.031 and 0.009 respectively) as shown in Table-4 and Figures (2,3,4&5).

Comparing the different genotypes (GG, GA, and AA) of the VEGFA (1154G/A) SNP in relation to SLICC, fever, vasculitis, and serositis revealed a statistically significant difference (p-value 0.024, 0.023, 0.004 and 0.047 respectively) while there were no significant differences in the presence of malar rash, discoid rash, arthritis, renal illness, hematological diseases, alopecia, myositis, or neurological disorders (p-value > 0.05) as demonstrated in Tables (5,6 &7).

Table 4: Relation between VEGF (1154G/A) SNP genotypes in SLE & different variables.

*p

Table 5: VEGF (1154G/A) polymorphism genotypes in relation to different parameters.

Table 6: VEGF (1154G/A) polymorphism genotypes in relation to different parameters.